minC [2018-08-12 19:11:24]

cell-division inhibitor (septum placement), destabilizes Z ring placement

Locus: BSU28000

Isoelectric point: 6.26

Molecular weight: 24.85 kDa

Protein length: 226 aa

Gene length: 678 bp

Function: septum placement

Product: cell-division inhibitor

Essential: no

Synonyms

Genomic Context

Loading

Categories containing this gene/protein

• Cellular processes → Cell envelope and cell division → Cell division → The Min system
• Lifestyles → Coping with stress → Cell envelope stress proteins (controlled by SigM, V, W, X, Y)
• Groups of genes → Membrane proteins

Gene

Coordinates: 2,858,584 → 2,859,264

Phenotypes of a mutant

• a whiA minC-minD mutant grows poorly, and the cells are filamentous PubMed

The protein

Catalyzed reaction/ biological activity

• The Min system prevents minicell formation adjacent to recently completed division sites by promoting the disassembly of the cytokinetic ring, thereby ensuring that cell division occurs only once per cell cycle PubMed
• binds the C-terminal domain of FtsZ to inhibit its polymerization PubMed

Protein family

• minC family (according to Swiss-Prot)

Structure

• 1HF2 (from Thermotoga maritima, 26% identity) PubMed

Localization

• polar/ septal at the cell membrane PubMed
• membrane binding/ polar localization depends on the proton motive force PubMed

Expression and Regulation

Operons

• Genes: mreB-mreC-mreD-minC-minD
  Description: PubMed

  Sigma factors

  • SigA: sigma factor, promoter p1, upstream of Maf PubMed, in SigA regulon
  • SigM: sigma factor, promoter p2, within Maf PubMed, in SigM regulon
  • SigH: sigma factor, promoter p4, upstream of MinC PubMed, in SigH regulon

  Regulatory mechanism

  • ComK: activation, PubMed, in ComK regulon

  Regulation

  • constitutively expressed PubMed

• Genes: minC-minD
  Description: PubMed

  Regulation

  • constitutively expressed PubMed

• Genes: maf-radC-mreB-mreC-mreD-minC-minD
  Description: PubMed

  Sigma factors

  • SigM: sigma factor, promoter p2 within Maf PubMed, in SigM regulon
  • SigA: sigma factor, promoter p1, upstream of Maf PubMed, in SigA regulon

  Regulatory mechanism

  • ComK: activation, PubMed, in ComK regulon

  Regulation

  • constitutively expressed PubMed

Biological materials

Mutant

• BSN375 (minC::aphA3) (available in Leendert Hamoen's, Sven Halbedel's and Jörg Stülke's labs)
• BKE28000 (ΔminC::erm trpC2) available at BGSC, PubMed, upstream reverse: _UP1_CACAATATTCACCTCAACAA, downstream forward: _UP4_ACAAGGCTTGAGGGAGGAAT
• BKK28000 (ΔminC::kan trpC2) available at BGSC, PubMed, upstream reverse: _UP1_CACAATATTCACCTCAACAA, downstream forward: _UP4_ACAAGGCTTGAGGGAGGAAT

Two-hybrid system

• B. pertussis adenylate cyclase-based bacterial two hybrid system (BACTH), available in Jörg Stülke's lab

References

Reviews

Loading

Original Publications

Loading